Transcript: Human NM_003805.5

Homo sapiens CASP2 and RIPK1 domain containing adaptor with death domain (CRADD), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CRADD (8738)
Length:
1189
CDS:
105..704

Additional Resources:

NCBI RefSeq record:
NM_003805.5
NBCI Gene record:
CRADD (8738)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003805.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303968 CCCATCAGACCGGCAGATTAA pLKO_005 446 CDS 100% 13.200 18.480 N CRADD n/a
2 TRCN0000107205 CATTACTTGAAAGGCCAGATT pLKO.1 854 3UTR 100% 4.950 6.930 N CRADD n/a
3 TRCN0000300283 CATTACTTGAAAGGCCAGATT pLKO_005 854 3UTR 100% 4.950 6.930 N CRADD n/a
4 TRCN0000107208 AGGTGACAGATTGACTGGGAT pLKO.1 401 CDS 100% 2.640 3.696 N CRADD n/a
5 TRCN0000303967 ACAATGCTCCTGCTGGATATC pLKO_005 264 CDS 100% 10.800 7.560 N CRADD n/a
6 TRCN0000303969 TAGATTCCCTACAGGAGTTTC pLKO_005 322 CDS 100% 10.800 7.560 N CRADD n/a
7 TRCN0000107206 CCCTAAAGCATTTGATACATT pLKO.1 299 CDS 100% 5.625 3.938 N CRADD n/a
8 TRCN0000107207 GACGGATATCTACCGCTGTAA pLKO.1 530 CDS 100% 4.950 3.465 N CRADD n/a
9 TRCN0000300326 GACGGATATCTACCGCTGTAA pLKO_005 530 CDS 100% 4.950 3.465 N CRADD n/a
10 TRCN0000107209 GTACCTCTACCAGGAAGGAAT pLKO.1 188 CDS 100% 0.000 0.000 N CRADD n/a
11 TRCN0000119881 GACTGGTTCTTCAGTACCTTT pLKO.1 175 CDS 100% 4.950 3.465 N Cradd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003805.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15642 pDONR223 0% 99.6% 98.9% None 88C>G;94C>G n/a
2 ccsbBroad304_15642 pLX_304 0% 99.6% 98.9% V5 88C>G;94C>G n/a
3 TRCN0000473154 GGAGGCGATCCTGAATTCCGGTTC pLX_317 68.5% 99.6% 98.9% V5 88C>G;94C>G n/a
Download CSV