Transcript: Human NM_003813.4

Homo sapiens ADAM metallopeptidase domain 21 (ADAM21), mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ADAM21 (8747)
Length:
2647
CDS:
242..2410

Additional Resources:

NCBI RefSeq record:
NM_003813.4
NBCI Gene record:
ADAM21 (8747)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003813.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433007 GAACAGGTCCTGAACGATTTC pLKO_005 1058 CDS 100% 10.800 15.120 N ADAM21 n/a
2 TRCN0000051724 CCTTCCTGAGACCTGCAATAT pLKO.1 2143 CDS 100% 13.200 9.240 N ADAM21 n/a
3 TRCN0000415972 TCTGTTGAACTGCACTCTAAG pLKO_005 1543 CDS 100% 10.800 7.560 N ADAM21 n/a
4 TRCN0000051726 GCCAGAAACACGTTGTTCATA pLKO.1 447 CDS 100% 5.625 3.938 N ADAM21 n/a
5 TRCN0000051727 CGCTGATTGTGATTCCTTCTT pLKO.1 2295 CDS 100% 4.950 3.465 N ADAM21 n/a
6 TRCN0000051725 GCATGGTTTCTGGAGCTAGTT pLKO.1 860 CDS 100% 4.950 2.970 N ADAM21 n/a
7 TRCN0000051723 GCACGCCAACAGTTGGAATTT pLKO.1 782 CDS 100% 13.200 6.600 Y ADAM21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003813.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02005 pDONR223 100% 99.5% 99.4% None (many diffs) n/a
2 ccsbBroad304_02005 pLX_304 0% 99.5% 99.4% V5 (many diffs) n/a
3 TRCN0000473632 AGCCACTTTTAAAGGACCTTTGTT pLX_317 20.8% 99.5% 99.4% V5 (many diffs) n/a
Download CSV