Transcript: Human NM_003840.5

Homo sapiens TNF receptor superfamily member 10d (TNFRSF10D), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
TNFRSF10D (8793)
Length:
3535
CDS:
93..1253

Additional Resources:

NCBI RefSeq record:
NM_003840.5
NBCI Gene record:
TNFRSF10D (8793)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003840.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413201 ACAAACTCTACTATCCAATAT pLKO_005 1353 3UTR 100% 13.200 9.240 N TNFRSF10D n/a
2 TRCN0000423221 GATGGTCAAGGTCAGTAATTG pLKO_005 587 CDS 100% 13.200 9.240 N TNFRSF10D n/a
3 TRCN0000058944 CCTCTCCCTATCACTACCTTA pLKO.1 712 CDS 100% 4.950 3.465 N TNFRSF10D n/a
4 TRCN0000058943 CGAGACCCTGAGTAACAGATA pLKO.1 923 CDS 100% 4.950 3.465 N TNFRSF10D n/a
5 TRCN0000058945 CTTCCAACAATTTGCCTTCTT pLKO.1 415 CDS 100% 4.950 3.465 N TNFRSF10D n/a
6 TRCN0000058947 GATCCTTAAGTTCGTCGTCTT pLKO.1 200 CDS 100% 4.050 2.835 N TNFRSF10D n/a
7 TRCN0000413561 TTAACGCACTTGGAGTAATTT pLKO_005 1405 3UTR 100% 15.000 9.000 N TNFRSF10D n/a
8 TRCN0000058946 CCTGCTATGTACAGTTTGTAA pLKO.1 437 CDS 100% 5.625 3.375 N TNFRSF10D n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1539 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003840.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07303 pDONR223 100% 99.9% 99.7% None 929T>C n/a
2 ccsbBroad304_07303 pLX_304 0% 99.9% 99.7% V5 929T>C n/a
3 TRCN0000474920 AGCTCTGACTGGGTAGTAGAGTGA pLX_317 31.8% 99.9% 99.7% V5 929T>C n/a
Download CSV