Transcript: Human NM_003842.5

Homo sapiens TNF receptor superfamily member 10b (TNFRSF10B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
TNFRSF10B (8795)
Length:
3998
CDS:
138..1460

Additional Resources:

NCBI RefSeq record:
NM_003842.5
NBCI Gene record:
TNFRSF10B (8795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003842.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005930 CCACAAAGAATCAGGTACAAA pLKO.1 674 CDS 100% 5.625 3.938 N TNFRSF10B n/a
2 TRCN0000279826 CCACAAAGAATCAGGTACAAA pLKO_005 674 CDS 100% 5.625 3.938 N TNFRSF10B n/a
3 TRCN0000005932 CTCACTGGAATGACCTCCTTT pLKO.1 451 CDS 100% 4.950 3.465 N TNFRSF10B n/a
4 TRCN0000279756 CTCACTGGAATGACCTCCTTT pLKO_005 451 CDS 100% 4.950 3.465 N TNFRSF10B n/a
5 TRCN0000005933 GCAGAAGATTGAGGACCACTT pLKO.1 1382 CDS 100% 4.050 2.835 N TNFRSF10B n/a
6 TRCN0000279755 GCAGAAGATTGAGGACCACTT pLKO_005 1382 CDS 100% 4.050 2.835 N TNFRSF10B n/a
7 TRCN0000005929 GCAGTCTCATTTGCACCCATA pLKO.1 2508 3UTR 100% 4.050 2.835 N TNFRSF10B n/a
8 TRCN0000279825 GCAGTCTCATTTGCACCCATA pLKO_005 2508 3UTR 100% 4.050 2.835 N TNFRSF10B n/a
9 TRCN0000005931 GCTGAGGACAATGTCCTCAAT pLKO.1 936 CDS 100% 0.495 0.347 N TNFRSF10B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003842.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07304 pDONR223 100% 99.8% 99.5% None 95C>T;572T>C n/a
2 ccsbBroad304_07304 pLX_304 0% 99.8% 99.5% V5 95C>T;572T>C n/a
Download CSV