Transcript: Human NM_003853.3

Homo sapiens interleukin 18 receptor accessory protein (IL18RAP), mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
IL18RAP (8807)
Length:
2672
CDS:
489..2288

Additional Resources:

NCBI RefSeq record:
NM_003853.3
NBCI Gene record:
IL18RAP (8807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003853.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005738 GCCTGTTGTGTCAAGATGATT pLKO.1 900 CDS 100% 5.625 7.875 N IL18RAP n/a
2 TRCN0000005736 CCTTTAACTATTAGCTGCAAA pLKO.1 1290 CDS 100% 4.950 6.930 N IL18RAP n/a
3 TRCN0000005735 CGAGTGAATTCTCTAGACCTT pLKO.1 2487 3UTR 100% 0.000 0.000 N IL18RAP n/a
4 TRCN0000005737 GCTCAGAATTACCTCTAGGAT pLKO.1 2201 CDS 100% 3.000 2.400 N IL18RAP n/a
5 TRCN0000419826 TGAAATCATTGAGCGTAATAT pLKO_005 1430 CDS 100% 15.000 10.500 N IL18RAP n/a
6 TRCN0000417542 CTAAACTCAAACCAGATATTC pLKO_005 1228 CDS 100% 13.200 9.240 N IL18RAP n/a
7 TRCN0000010962 CCCAGTATCTTTGAACTACAA pLKO.1 1953 CDS 100% 4.950 3.465 N IL18RAP n/a
8 TRCN0000419724 GAATAATTCTGGGTCATATAT pLKO_005 842 CDS 100% 15.000 9.000 N IL18RAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003853.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02019 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02019 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473327 TATCATGGTATTTCGAAGTTTTAG pLX_317 27% 100% 100% V5 n/a
Download CSV