Transcript: Human NM_003878.3

Homo sapiens gamma-glutamyl hydrolase (GGH), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GGH (8836)
Length:
1248
CDS:
39..995

Additional Resources:

NCBI RefSeq record:
NM_003878.3
NBCI Gene record:
GGH (8836)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003878.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051339 CAGTCCAATTTATACTGGAAA pLKO.1 938 CDS 100% 4.950 6.930 N GGH n/a
2 TRCN0000051342 GTGCGAGAGTTGTACCAGTAA pLKO.1 241 CDS 100% 4.950 6.930 N GGH n/a
3 TRCN0000300996 GTGCGAGAGTTGTACCAGTAA pLKO_005 241 CDS 100% 4.950 6.930 N GGH n/a
4 TRCN0000051341 GATGGCAAGATTGAGTTTATT pLKO.1 702 CDS 100% 15.000 10.500 N GGH n/a
5 TRCN0000300997 GATGGCAAGATTGAGTTTATT pLKO_005 702 CDS 100% 15.000 10.500 N GGH n/a
6 TRCN0000051340 CCATGCACCTAATGCTGTGAA pLKO.1 815 CDS 100% 4.950 3.465 N GGH n/a
7 TRCN0000331398 CCATGCACCTAATGCTGTGAA pLKO_005 815 CDS 100% 4.950 3.465 N GGH n/a
8 TRCN0000051338 GCTTATTAACTGCCACAGATA pLKO.1 481 CDS 100% 4.950 3.465 N GGH n/a
9 TRCN0000300995 GCTTATTAACTGCCACAGATA pLKO_005 481 CDS 100% 4.950 3.465 N GGH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003878.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02029 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02029 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472249 GACTCGTCGCGGCACAGCATGTTC pLX_317 36.9% 100% 100% V5 n/a
Download CSV