Transcript: Human NM_003916.5

Homo sapiens adaptor related protein complex 1 subunit sigma 2 (AP1S2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
AP1S2 (8905)
Length:
2119
CDS:
127..600

Additional Resources:

NCBI RefSeq record:
NM_003916.5
NBCI Gene record:
AP1S2 (8905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003916.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059454 CCACGTAGTGTTCTTGAAGAA pLKO.1 565 CDS 100% 4.950 6.930 N AP1S2 n/a
2 TRCN0000333507 CCACGTAGTGTTCTTGAAGAA pLKO_005 565 CDS 100% 4.950 6.930 N AP1S2 n/a
3 TRCN0000380172 GATGATGTCTTGTCAGTATTA pLKO_005 688 3UTR 100% 13.200 9.240 N AP1S2 n/a
4 TRCN0000381420 ACTGCAGGAGGAAGCTGAAAC pLKO_005 543 CDS 100% 10.800 7.560 N AP1S2 n/a
5 TRCN0000381242 TAACTCTCCTCCCTTGTTGAT pLKO_005 598 CDS 100% 4.950 3.465 N AP1S2 n/a
6 TRCN0000382140 TGACAAAGGAAACTCTTAAAT pLKO_005 945 3UTR 100% 15.000 9.000 N AP1S2 n/a
7 TRCN0000379633 GGGAATTGACATGTCACATAT pLKO_005 1039 3UTR 100% 13.200 7.920 N AP1S2 n/a
8 TRCN0000059456 CCCACTATCAGACAAAGAGAA pLKO.1 186 CDS 100% 4.950 2.970 N AP1S2 n/a
9 TRCN0000333442 CCCACTATCAGACAAAGAGAA pLKO_005 186 CDS 100% 4.950 2.970 N AP1S2 n/a
10 TRCN0000059457 GCGAGATCTGAAGATTGTTTA pLKO.1 279 CDS 100% 13.200 6.600 Y AP1S2 n/a
11 TRCN0000333505 GCGAGATCTGAAGATTGTTTA pLKO_005 279 CDS 100% 13.200 6.600 Y AP1S2 n/a
12 TRCN0000313402 CTATTGAGGATCAGGACAATG pLKO_005 332 CDS 100% 10.800 5.400 Y Ap1s2 n/a
13 TRCN0000059455 GCAGTGTCTGTGAACTAGATA pLKO.1 410 CDS 100% 5.625 2.813 Y AP1S2 n/a
14 TRCN0000333506 GCAGTGTCTGTGAACTAGATA pLKO_005 410 CDS 100% 5.625 2.813 Y AP1S2 n/a
15 TRCN0000059453 CCTGGAAATAATTCATCGTTA pLKO.1 363 CDS 100% 4.950 2.475 Y AP1S2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003916.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02047 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02047 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473696 CCATGTTTTGTACAACTTATCTTT pLX_317 86.3% 100% 100% V5 n/a
Download CSV