Transcript: Human NM_004066.3

Homo sapiens centrin 1 (CETN1), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
CETN1 (1068)
Length:
1735
CDS:
30..548

Additional Resources:

NCBI RefSeq record:
NM_004066.3
NBCI Gene record:
CETN1 (1068)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004066.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055763 GCAAGAAGTTCGGGAAGCATT pLKO.1 119 CDS 100% 4.950 6.930 N CETN1 n/a
2 TRCN0000055764 GAGATGATCGACGAAGCTGAT pLKO.1 459 CDS 100% 4.050 5.670 N CETN1 n/a
3 TRCN0000055765 TCCGAGAAGGACACCAAAGAA pLKO.1 321 CDS 100% 5.625 3.938 N CETN1 n/a
4 TRCN0000055766 GAAGATCAGCTTCAATGACTT pLKO.1 275 CDS 100% 4.950 3.465 N CETN1 n/a
5 TRCN0000055767 CAGAAGCAAGAAGTTCGGGAA pLKO.1 114 CDS 100% 2.160 1.512 N CETN1 n/a
6 TRCN0000104632 CAGGAGATGATCGACGAAGTA pLKO.1 456 CDS 100% 4.950 3.465 N Tnnc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004066.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00293 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00293 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469778 AGCTTGAGTTCATTGCGGATAAAC pLX_317 76.8% 100% 100% V5 n/a
Download CSV