Transcript: Human NM_004096.5

Homo sapiens eukaryotic translation initiation factor 4E binding protein 2 (EIF4EBP2), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
EIF4EBP2 (1979)
Length:
7491
CDS:
258..620

Additional Resources:

NCBI RefSeq record:
NM_004096.5
NBCI Gene record:
EIF4EBP2 (1979)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004096.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117813 CGGGAGGAACTCGAATCATTT pLKO.1 397 CDS 100% 13.200 18.480 N EIF4EBP2 n/a
2 TRCN0000307020 CGGGAGGAACTCGAATCATTT pLKO_005 397 CDS 100% 13.200 18.480 N EIF4EBP2 n/a
3 TRCN0000117816 CTCGAATCATTTATGACAGAA pLKO.1 406 CDS 100% 4.950 6.930 N EIF4EBP2 n/a
4 TRCN0000117814 CGCAGCTACCTCATGACTATT pLKO.1 340 CDS 100% 13.200 10.560 N EIF4EBP2 n/a
5 TRCN0000307018 CGCAGCTACCTCATGACTATT pLKO_005 340 CDS 100% 13.200 10.560 N EIF4EBP2 n/a
6 TRCN0000117812 GCTGTATTTCTGTAGAGCTAA pLKO.1 858 3UTR 100% 4.950 3.465 N EIF4EBP2 n/a
7 TRCN0000289076 GCTGTATTTCTGTAGAGCTAA pLKO_005 858 3UTR 100% 4.950 3.465 N EIF4EBP2 n/a
8 TRCN0000117815 GCACCTTAATTGAAGACTCCA pLKO.1 511 CDS 100% 2.640 1.848 N EIF4EBP2 n/a
9 TRCN0000289077 GCACCTTAATTGAAGACTCCA pLKO_005 511 CDS 100% 2.640 1.848 N EIF4EBP2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5407 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5407 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004096.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00491 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00491 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465782 CCCACAAGCCCAAGACATCACTGC pLX_317 73.4% 100% 100% V5 n/a
Download CSV