Transcript: Human NM_004102.5

Homo sapiens fatty acid binding protein 3 (FABP3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
FABP3 (2170)
Length:
1097
CDS:
63..464

Additional Resources:

NCBI RefSeq record:
NM_004102.5
NBCI Gene record:
FABP3 (2170)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004102.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244897 ACACTTGTGCGGGAGCTAATT pLKO_005 372 CDS 100% 13.200 18.480 N FABP3 n/a
2 TRCN0000105192 GACTACATGAAGTCACTCGGT pLKO.1 117 CDS 100% 0.660 0.924 N Fabp3 n/a
3 TRCN0000059682 GCTAGTGGACAGCAAGAATTT pLKO.1 92 CDS 100% 13.200 9.240 N FABP3 n/a
4 TRCN0000244895 GCTAGTGGACAGCAAGAATTT pLKO_005 92 CDS 100% 13.200 9.240 N FABP3 n/a
5 TRCN0000244896 ATGACCAAGCCTACCACAATC pLKO_005 168 CDS 100% 10.800 7.560 N FABP3 n/a
6 TRCN0000244898 GCACTCGCACTTATGAGAAAG pLKO_005 436 CDS 100% 10.800 7.560 N FABP3 n/a
7 TRCN0000059680 GACCAAGCCTACCACAATCAT pLKO.1 170 CDS 100% 5.625 3.938 N FABP3 n/a
8 TRCN0000059681 GACAGGAAGGTCAAGTCCATT pLKO.1 294 CDS 100% 4.950 3.465 N FABP3 n/a
9 TRCN0000244899 AGGGTGCTCTGAGGTCAATAA pLKO_005 658 3UTR 100% 13.200 7.920 N FABP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004102.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00535 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00535 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475065 ACGTTCTAGCTCTGAGCCAAAGCG pLX_317 100% 100% 100% V5 n/a
Download CSV