Transcript: Human NM_004104.5

Homo sapiens fatty acid synthase (FASN), mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
FASN (2194)
Length:
8464
CDS:
124..7659

Additional Resources:

NCBI RefSeq record:
NM_004104.5
NBCI Gene record:
FASN (2194)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004104.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003127 CATGGAGCGTATCTGTGAGAA pLKO.1 6243 CDS 100% 4.950 6.930 N FASN n/a
2 TRCN0000280102 CATGGAGCGTATCTGTGAGAA pLKO_005 6243 CDS 100% 4.950 6.930 N FASN n/a
3 TRCN0000003129 CCTCCCACAATTAAACCGCAT pLKO.1 8434 3UTR 100% 2.160 3.024 N FASN n/a
4 TRCN0000003126 GCTACGACTACGGCCCTCATT pLKO.1 3116 CDS 100% 1.650 2.310 N FASN n/a
5 TRCN0000280103 GCTGCTAGATGTAGGTGTTAG pLKO_005 7792 3UTR 100% 10.800 8.640 N FASN n/a
6 TRCN0000003128 CGAGAGCACCTTTGATGACAT pLKO.1 1749 CDS 100% 4.950 3.960 N FASN n/a
7 TRCN0000297762 CGAGAGCACCTTTGATGACAT pLKO_005 1749 CDS 100% 4.950 3.960 N FASN n/a
8 TRCN0000003125 CCTACTGGATGCGTTCTTCAA pLKO.1 5505 CDS 100% 4.950 3.465 N FASN n/a
9 TRCN0000280100 CCTACTGGATGCGTTCTTCAA pLKO_005 5505 CDS 100% 4.950 3.465 N FASN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004104.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10818 pDONR223 100% 17.4% 17.4% None 1_6216del;6402C>T n/a
2 ccsbBroad304_10818 pLX_304 0% 17.4% 17.4% V5 1_6216del;6402C>T n/a
3 TRCN0000466161 TTATGTGTTGTAGCTGGCACATAC pLX_317 29.3% 17.4% 17.4% V5 1_6216del;6402C>T n/a
Download CSV