Transcript: Human NM_004109.5

Homo sapiens ferredoxin 1 (FDX1), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
FDX1 (2230)
Length:
3144
CDS:
174..728

Additional Resources:

NCBI RefSeq record:
NM_004109.5
NBCI Gene record:
FDX1 (2230)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004109.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056595 GTCCACTTTATAAACCGTGAT pLKO.1 378 CDS 100% 4.050 3.240 N FDX1 n/a
2 TRCN0000306767 GTCCACTTTATAAACCGTGAT pLKO_005 378 CDS 100% 4.050 3.240 N FDX1 n/a
3 TRCN0000056597 GATGCCAGACAATCCATTGAT pLKO.1 690 CDS 100% 5.625 3.938 N FDX1 n/a
4 TRCN0000056594 GCAATCACTGATGAGGAGAAT pLKO.1 558 CDS 100% 4.950 3.465 N FDX1 n/a
5 TRCN0000307071 GCAATCACTGATGAGGAGAAT pLKO_005 558 CDS 100% 4.950 3.465 N FDX1 n/a
6 TRCN0000056593 GCTGCCAAATCTGTTTGACAA pLKO.1 625 CDS 100% 4.950 3.465 N FDX1 n/a
7 TRCN0000289562 GCTGCCAAATCTGTTTGACAA pLKO_005 625 CDS 100% 4.950 3.465 N FDX1 n/a
8 TRCN0000056596 TGGTGAAACATTAACAACCAA pLKO.1 398 CDS 100% 3.000 2.100 N FDX1 n/a
9 TRCN0000289563 TGGTGAAACATTAACAACCAA pLKO_005 398 CDS 100% 3.000 2.100 N FDX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004109.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00549 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00549 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000491995 TTCGATTATTTAGGCATGGCATCT pLX_317 71.6% 100% 100% V5 n/a
Download CSV