Transcript: Human NM_004113.6

Homo sapiens fibroblast growth factor 12 (FGF12), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
FGF12 (2257)
Length:
5353
CDS:
189..734

Additional Resources:

NCBI RefSeq record:
NM_004113.6
NBCI Gene record:
FGF12 (2257)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004113.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425873 AGAACCATCGCTACATGAAAT pLKO_005 629 CDS 100% 13.200 18.480 N FGF12 n/a
2 TRCN0000421832 CTGATGTTATATACTCAATAG pLKO_005 1119 3UTR 100% 10.800 15.120 N FGF12 n/a
3 TRCN0000058474 GACTCAATAAAGAAGGTCAAA pLKO.1 529 CDS 100% 4.950 6.930 N FGF12 n/a
4 TRCN0000058477 CTACACTCTCTTCAATCTAAT pLKO.1 308 CDS 100% 13.200 9.240 N FGF12 n/a
5 TRCN0000058476 GCTTGGTTTCTGGGACTCAAT pLKO.1 516 CDS 100% 4.950 3.465 N FGF12 n/a
6 TRCN0000058475 CCAACCATGAATGGAGGCAAA pLKO.1 690 CDS 100% 4.050 2.835 N FGF12 n/a
7 TRCN0000058473 GCCATGAATGGTGAAGGCTAT pLKO.1 384 CDS 100% 4.050 2.835 N FGF12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004113.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06210 pDONR223 100% 99.6% 99.4% None 24C>A;446C>A n/a
2 ccsbBroad304_06210 pLX_304 0% 99.6% 99.4% V5 24C>A;446C>A n/a
3 TRCN0000473712 GAGGGATGGAATACATTTCCAACG pLX_317 100% 99.6% 99.4% V5 24C>A;446C>A n/a
Download CSV