Transcript: Human NM_004120.5

Homo sapiens guanylate binding protein 2 (GBP2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GBP2 (2634)
Length:
4088
CDS:
270..2045

Additional Resources:

NCBI RefSeq record:
NM_004120.5
NBCI Gene record:
GBP2 (2634)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004120.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116185 GCTTTCGCTAAAGCTAAGAAA pLKO.1 872 CDS 100% 0.563 0.788 N GBP2 n/a
2 TRCN0000423933 ACTCCTCACCTGGTAACAATT pLKO_005 733 CDS 100% 13.200 10.560 N GBP2 n/a
3 TRCN0000431758 TAGACGACTCAGCTGACTTTG pLKO_005 757 CDS 100% 10.800 8.640 N GBP2 n/a
4 TRCN0000418549 ATTGAAGTGGAACGTATAAAG pLKO_005 1728 CDS 100% 13.200 9.240 N GBP2 n/a
5 TRCN0000116182 GCAATTCAACTCATGCTTATT pLKO.1 2230 3UTR 100% 13.200 9.240 N GBP2 n/a
6 TRCN0000116186 CCCTTTAGAAGAAGATGTCAA pLKO.1 1511 CDS 100% 4.950 3.465 N GBP2 n/a
7 TRCN0000116184 GCATGGCTTTACTTCAGGATA pLKO.1 1483 CDS 100% 4.950 3.465 N GBP2 n/a
8 TRCN0000116183 GCCAATATGTAACATACTCTA pLKO.1 2024 CDS 100% 4.950 3.465 N GBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004120.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06264 pDONR223 100% 99.9% 99.8% None 929T>G n/a
2 ccsbBroad304_06264 pLX_304 0% 99.9% 99.8% V5 929T>G n/a
3 TRCN0000472242 ACACATGCGGCTCGGTCTTCGCTG pLX_317 27.3% 99.9% 99.8% V5 929T>G n/a
Download CSV