Transcript: Human NM_004179.3

Homo sapiens tryptophan hydroxylase 1 (TPH1), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
TPH1 (7166)
Length:
4826
CDS:
56..1390

Additional Resources:

NCBI RefSeq record:
NM_004179.3
NBCI Gene record:
TPH1 (7166)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056624 CGGGAGGATAATATCCCACAA pLKO.1 674 CDS 100% 4.050 5.670 N TPH1 n/a
2 TRCN0000056627 GCGTCCATTTGGAGTGAAGTA pLKO.1 1237 CDS 100% 4.950 3.960 N TPH1 n/a
3 TRCN0000413943 ACTTGGCTATGAACTATAAAC pLKO_005 504 CDS 100% 13.200 9.240 N TPH1 n/a
4 TRCN0000417439 AGAAGTTGTTTGACCCAATAG pLKO_005 1670 3UTR 100% 10.800 7.560 N TPH1 n/a
5 TRCN0000120051 GTGAACTCAAACATGCACTTT pLKO.1 1071 CDS 100% 4.950 3.465 N Tph1 n/a
6 TRCN0000056625 GCCAAAGTAAAGCCCTTTGAT pLKO.1 1100 CDS 100% 0.563 0.394 N TPH1 n/a
7 TRCN0000056623 CCCAAGAAATTGGCTTGGCTT pLKO.1 924 CDS 100% 0.264 0.185 N TPH1 n/a
8 TRCN0000056626 CTGTGAATCTACCAGATAATT pLKO.1 318 CDS 100% 15.000 9.000 N TPH1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4394 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3954 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01700 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01700 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478856 CCAACAACGACGCTCCTGAGAGAC pLX_317 26.8% 100% 100% V5 n/a
Download CSV