Transcript: Human NM_004188.7

Homo sapiens growth factor independent 1B transcriptional repressor (GFI1B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-26
Taxon:
Homo sapiens (human)
Gene:
GFI1B (8328)
Length:
2455
CDS:
826..1818

Additional Resources:

NCBI RefSeq record:
NM_004188.7
NBCI Gene record:
GFI1B (8328)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004188.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414050 CTTACCCTGTCTGGATCAACA pLKO_005 1983 3UTR 100% 4.950 6.930 N GFI1B n/a
2 TRCN0000013178 CCGGCCTCTTTCTGGCTATAA pLKO.1 2220 3UTR 100% 13.200 10.560 N GFI1B n/a
3 TRCN0000435063 CATGAAGAAGCACACCTACAT pLKO_005 1611 CDS 100% 4.950 3.465 N GFI1B n/a
4 TRCN0000013180 CCACTGTGTGAAGTGCAACAA pLKO.1 1314 CDS 100% 4.950 3.465 N GFI1B n/a
5 TRCN0000013181 CCTTAGCACTCTATTCCCAAA pLKO.1 960 CDS 100% 4.050 2.835 N GFI1B n/a
6 TRCN0000416286 GTTTCCAGGTGTGCTCAAGTG pLKO_005 2057 3UTR 100% 4.050 2.835 N GFI1B n/a
7 TRCN0000013179 CCCATTCTACAAGCCTAGCTT pLKO.1 1122 CDS 100% 3.000 2.100 N GFI1B n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 376 5UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004188.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.