Transcript: Human NM_004198.3

Homo sapiens cholinergic receptor nicotinic alpha 6 subunit (CHRNA6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CHRNA6 (8973)
Length:
2400
CDS:
357..1841

Additional Resources:

NCBI RefSeq record:
NM_004198.3
NBCI Gene record:
CHRNA6 (8973)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431203 GAAATTTACAGACACCATATT pLKO_005 1864 3UTR 100% 13.200 18.480 N CHRNA6 n/a
2 TRCN0000060421 CATTAGAAGATTGCCGATGTT pLKO.1 1061 CDS 100% 4.950 6.930 N CHRNA6 n/a
3 TRCN0000415202 GAGTATTTCTTTGGGTATTTA pLKO_005 1750 CDS 100% 15.000 10.500 N CHRNA6 n/a
4 TRCN0000060420 GCCACAAGCAAGAGAAGATTA pLKO.1 1569 CDS 100% 13.200 9.240 N CHRNA6 n/a
5 TRCN0000416266 GCGTTCCTGCAGATAAGATTT pLKO_005 682 CDS 100% 13.200 9.240 N CHRNA6 n/a
6 TRCN0000415390 TTGATGCCTCTGGCTACAAAC pLKO_005 982 CDS 100% 10.800 7.560 N CHRNA6 n/a
7 TRCN0000060422 GCTTCCATTGTCACAAATCAA pLKO.1 1540 CDS 100% 5.625 3.938 N CHRNA6 n/a
8 TRCN0000060418 CCAATGGAATATGATGGCATT pLKO.1 651 CDS 100% 4.050 2.835 N CHRNA6 n/a
9 TRCN0000060419 GCTGGTCATCACAGAAACCAT pLKO.1 1214 CDS 100% 3.000 2.100 N CHRNA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004198.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02056 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02056 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469017 ATCCTTGAAAAAGATCTAACTGGC pLX_317 26.1% 100% 100% V5 n/a
Download CSV