Transcript: Human NM_004204.4

Homo sapiens phosphatidylinositol glycan anchor biosynthesis class Q (PIGQ), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-26
Taxon:
Homo sapiens (human)
Gene:
PIGQ (9091)
Length:
2987
CDS:
139..1884

Additional Resources:

NCBI RefSeq record:
NM_004204.4
NBCI Gene record:
PIGQ (9091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004204.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243324 GTCCCTCCTCTCGGACATTAT pLKO_005 1293 CDS 100% 13.200 10.560 N PIGQ n/a
2 TRCN0000243327 TCCGCCTCCTGATGCAGATAA pLKO_005 1715 CDS 100% 13.200 9.240 N PIGQ n/a
3 TRCN0000243328 ACTGACCCAGCCGTACCTATT pLKO_005 2560 3UTR 100% 10.800 7.560 N PIGQ n/a
4 TRCN0000243326 AGGTCATGCTCATCTTCTATG pLKO_005 512 CDS 100% 10.800 7.560 N PIGQ n/a
5 TRCN0000178916 CAGGTCATGCTCATCTTCTAT pLKO.1 511 CDS 100% 5.625 3.938 N PIGQ n/a
6 TRCN0000243325 TTCCGCAGTGACCGCTTTGAT pLKO_005 664 CDS 100% 5.625 3.938 N PIGQ n/a
7 TRCN0000180474 GCCAAATCTGTCTCCCTTCAT pLKO.1 2614 3UTR 100% 4.950 3.465 N PIGQ n/a
8 TRCN0000179525 GCTAATCTTCAGTACACGGAA pLKO.1 912 CDS 100% 2.640 1.848 N PIGQ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004204.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07357 pDONR223 100% 71.7% 68.5% None 439C>T;1531_1592del;1743_1744ins599 n/a
2 ccsbBroad304_07357 pLX_304 0% 71.7% 68.5% V5 439C>T;1531_1592del;1743_1744ins599 n/a
3 TRCN0000474913 CCCATGGGCACGACATATCCGCGC pLX_317 18.2% 71.7% 68.5% V5 439C>T;1531_1592del;1743_1744ins599 n/a
Download CSV