Transcript: Human NM_004251.5

Homo sapiens RAB9A, member RAS oncogene family (RAB9A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RAB9A (9367)
Length:
2034
CDS:
277..882

Additional Resources:

NCBI RefSeq record:
NM_004251.5
NBCI Gene record:
RAB9A (9367)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004251.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382231 AGATTGTTGATGCATTCTAAC pLKO_005 888 3UTR 100% 10.800 15.120 N RAB9A n/a
2 TRCN0000307297 GACAACGGCGACTATCCTTAT pLKO_005 706 CDS 100% 10.800 15.120 N RAB9A n/a
3 TRCN0000379959 TAGTGTCGATGATTCACAAAG pLKO_005 537 CDS 100% 10.800 15.120 N RAB9A n/a
4 TRCN0000380775 GGAGAAGAGAATTAGCGTTTG pLKO_005 944 3UTR 100% 6.000 8.400 N RAB9A n/a
5 TRCN0000381169 TTTGAGGAAGCGGTTCGAAGA pLKO_005 769 CDS 100% 4.050 5.670 N RAB9A n/a
6 TRCN0000294348 CAGTGTATCATCTACTAATAA pLKO_005 968 3UTR 100% 15.000 10.500 N RAB9A n/a
7 TRCN0000343388 CGAAGCCTGAGGACACCATTT pLKO_005 484 CDS 100% 10.800 7.560 N RAB9A n/a
8 TRCN0000343387 GGGTAACAAGATTGACATAAG pLKO_005 642 CDS 100% 10.800 7.560 N RAB9A n/a
9 TRCN0000381873 ACAGTCAATCTTCACCGAAAG pLKO_005 835 CDS 100% 6.000 4.200 N RAB9A n/a
10 TRCN0000048104 CCGAGGATAGGTCAGATCATT pLKO.1 800 CDS 100% 5.625 3.938 N RAB9A n/a
11 TRCN0000286934 CCGAGGATAGGTCAGATCATT pLKO_005 800 CDS 100% 5.625 3.938 N RAB9A n/a
12 TRCN0000048105 CACAGTCAATCTTCACCGAAA pLKO.1 834 CDS 100% 4.050 2.835 N RAB9A n/a
13 TRCN0000048103 GAGTTCACTTATGAACAGATA pLKO.1 336 CDS 100% 0.495 0.347 N RAB9A n/a
14 TRCN0000048107 GCTCTTCCATACAATAGGTGT pLKO.1 381 CDS 100% 2.640 1.584 N RAB9A n/a
15 TRCN0000048106 CCAGAACTTAAGTAACTGGAA pLKO.1 561 CDS 100% 2.640 1.320 Y RAB9A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004251.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02150 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02150 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467524 GTTTTCCGTGTACAAGGTCCCCTG pLX_317 69.5% 100% 100% V5 n/a
Download CSV