Transcript: Human NM_004271.4

Homo sapiens lymphocyte antigen 86 (LY86), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
LY86 (9450)
Length:
859
CDS:
16..504

Additional Resources:

NCBI RefSeq record:
NM_004271.4
NBCI Gene record:
LY86 (9450)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004271.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139903 GATTTACTATGCTGGGCCTGT pLKO.1 372 CDS 100% 2.160 3.024 N LY86 n/a
2 TRCN0000143541 GAAAGGAGAGCAGATTTACTA pLKO.1 360 CDS 100% 5.625 3.938 N LY86 n/a
3 TRCN0000139368 CTCAGGGAGAATACCAGGTTT pLKO.1 416 CDS 100% 4.950 3.465 N LY86 n/a
4 TRCN0000139706 CTGAGAGAGGACATCAAAGAG pLKO.1 235 CDS 100% 4.950 3.465 N LY86 n/a
5 TRCN0000142534 GAGAGGACATCAAAGAGCTTT pLKO.1 239 CDS 100% 4.950 3.465 N LY86 n/a
6 TRCN0000141862 GAATTTCTCCTATCCCATCTG pLKO.1 300 CDS 100% 4.050 2.835 N LY86 n/a
7 TRCN0000143428 GAATTATTCTGAGAGAGGACA pLKO.1 227 CDS 100% 2.640 1.848 N LY86 n/a
8 TRCN0000143902 CCTGAATTTACTATTCCTCAG pLKO.1 400 CDS 100% 2.250 1.575 N LY86 n/a
9 TRCN0000140027 GAAGAAGGAAAGGAGAGCAGA pLKO.1 353 CDS 100% 2.640 1.584 N LY86 n/a
10 TRCN0000141393 CTTTCTGTGGAAGAAGGAAAG pLKO.1 344 CDS 100% 0.600 0.360 N LY86 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004271.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02166 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02166 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471492 AGAACTTATATGCAACAGCTCAAG pLX_317 90.9% 100% 100% V5 n/a
Download CSV