Transcript: Human NM_004274.5

Homo sapiens A-kinase anchoring protein 6 (AKAP6), mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
AKAP6 (9472)
Length:
14984
CDS:
146..7105

Additional Resources:

NCBI RefSeq record:
NM_004274.5
NBCI Gene record:
AKAP6 (9472)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004274.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037914 CCTGGCTTGATGGACCTAAAT pLKO.1 3755 CDS 100% 13.200 18.480 N AKAP6 n/a
2 TRCN0000229378 TAAGTCCCTCTGTCGTGAAAT pLKO_005 3514 CDS 100% 13.200 18.480 N AKAP6 n/a
3 TRCN0000037915 CGGCATCTCTAACAGAACTTA pLKO.1 5199 CDS 100% 5.625 7.875 N AKAP6 n/a
4 TRCN0000037916 CGAAGATTGTTCAGTACACAA pLKO.1 6298 CDS 100% 4.950 6.930 N AKAP6 n/a
5 TRCN0000218838 ACCAACTGGTAGTCCATTAAA pLKO_005 7468 3UTR 100% 15.000 12.000 N AKAP6 n/a
6 TRCN0000037917 CCATCAGAGATTGCTTTAATT pLKO.1 1260 CDS 100% 15.000 10.500 N AKAP6 n/a
7 TRCN0000218046 GAGGCAAATGGTTGATCTAAA pLKO_005 1378 CDS 100% 13.200 9.240 N AKAP6 n/a
8 TRCN0000037918 GCAGAGATGGATGACCTTAAA pLKO.1 2573 CDS 100% 13.200 9.240 N AKAP6 n/a
9 TRCN0000229379 GGACATAAGTAACAAGTTAAT pLKO_005 3811 CDS 100% 13.200 9.240 N AKAP6 n/a
10 TRCN0000229377 GGCTTAACGACTGCTATAAAG pLKO_005 1596 CDS 100% 13.200 9.240 N AKAP6 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 11430 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 11431 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 11589 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004274.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.