Transcript: Human NM_004281.3

Homo sapiens BAG cochaperone 3 (BAG3), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
BAG3 (9531)
Length:
2608
CDS:
307..2034

Additional Resources:

NCBI RefSeq record:
NM_004281.3
NBCI Gene record:
BAG3 (9531)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004281.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293299 ACATCTCCATTCCGGTGATAC pLKO_005 920 CDS 100% 10.800 15.120 N BAG3 n/a
2 TRCN0000293370 TCAATTACCCATCACATAAAT pLKO_005 2373 3UTR 100% 15.000 10.500 N BAG3 n/a
3 TRCN0000293333 ACCTGATGATCGAAGAGTATT pLKO_005 1658 CDS 100% 13.200 9.240 N BAG3 n/a
4 TRCN0000294937 ACCTGATGATCGAAGAGTATT pLKO_005 1658 CDS 100% 13.200 9.240 N Bag3 n/a
5 TRCN0000007293 CCTGGACACATCCCAATTCAA pLKO.1 1306 CDS 100% 5.625 3.938 N BAG3 n/a
6 TRCN0000007294 CTTGAACAGAAAGCCATTGAT pLKO.1 1786 CDS 100% 5.625 3.938 N BAG3 n/a
7 TRCN0000293298 CTTGAACAGAAAGCCATTGAT pLKO_005 1786 CDS 100% 5.625 3.938 N BAG3 n/a
8 TRCN0000007292 GAAGGCAAGAAGACTGACAAA pLKO.1 1633 CDS 100% 4.950 3.465 N BAG3 n/a
9 TRCN0000293372 GAAGGCAAGAAGACTGACAAA pLKO_005 1633 CDS 100% 4.950 3.465 N BAG3 n/a
10 TRCN0000007291 CCAATTCAAGTGATCCGCAAA pLKO.1 1318 CDS 100% 4.050 2.835 N BAG3 n/a
11 TRCN0000007290 GCATGCATTTCAGAGACTTTA pLKO.1 2093 3UTR 100% 13.200 7.920 N BAG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004281.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15670 pDONR223 0% 99.9% 100% None 1296A>G n/a
2 ccsbBroad304_15670 pLX_304 0% 99.9% 100% V5 1296A>G n/a
Download CSV