Transcript: Human NM_004283.4

Homo sapiens RAB3D, member RAS oncogene family (RAB3D), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
RAB3D (9545)
Length:
4240
CDS:
251..910

Additional Resources:

NCBI RefSeq record:
NM_004283.4
NBCI Gene record:
RAB3D (9545)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004283.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380814 ACTTCCTTCCTGTTCCGATAC pLKO_005 356 CDS 100% 6.000 4.800 N RAB3D n/a
2 TRCN0000047778 GCCTTCTAGCTTAGAACCATT pLKO.1 1248 3UTR 100% 4.950 3.960 N RAB3D n/a
3 TRCN0000379694 GCCACGCAAATCAAGACCTAC pLKO_005 599 CDS 100% 4.050 3.240 N RAB3D n/a
4 TRCN0000382150 AGTACTGTGGGCATCGATTTC pLKO_005 407 CDS 100% 10.800 7.560 N RAB3D n/a
5 TRCN0000382389 ATGGCTCATTCCTTCACAATG pLKO_005 1042 3UTR 100% 10.800 7.560 N RAB3D n/a
6 TRCN0000380528 CCTTCTAGCTTAGAACCATTT pLKO_005 1249 3UTR 100% 10.800 7.560 N RAB3D n/a
7 TRCN0000047779 CATCAATGTGAAGCAGGTCTT pLKO.1 757 CDS 100% 4.050 2.835 N RAB3D n/a
8 TRCN0000047782 GACTTCCTTCCTGTTCCGATA pLKO.1 355 CDS 100% 4.050 2.835 N RAB3D n/a
9 TRCN0000381815 TCAATGTGAAGCAGGTCTTCG pLKO_005 759 CDS 100% 4.050 2.835 N RAB3D n/a
10 TRCN0000047781 CATCGCCAATCAGGAATCCTT pLKO.1 559 CDS 100% 3.000 2.100 N RAB3D n/a
11 TRCN0000047780 GACTATATGTTCAAACTGCTA pLKO.1 308 CDS 100% 2.640 1.848 N RAB3D n/a
12 TRCN0000379425 GGTTGGGCAGGACTGATATTC pLKO_005 1285 3UTR 100% 13.200 7.920 N RAB3D n/a
13 TRCN0000381975 AGCTGGTGGAAGATGGTTCAT pLKO_005 1309 3UTR 100% 4.950 2.970 N RAB3D n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2954 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2954 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004283.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07442 pDONR223 100% 99.8% 99.5% None 7T>G n/a
2 ccsbBroad304_07442 pLX_304 0% 99.8% 99.5% V5 7T>G n/a
3 TRCN0000491803 TTATCCCGTGAAAGACGACAATTC pLX_317 47.5% 99.8% 99.5% V5 7T>G n/a
Download CSV