Transcript: Human NM_004306.4

Homo sapiens annexin A13 (ANXA13), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ANXA13 (312)
Length:
1456
CDS:
60..1010

Additional Resources:

NCBI RefSeq record:
NM_004306.4
NBCI Gene record:
ANXA13 (312)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004306.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381174 ACCCTTAAGAGTCCCGGATTA pLKO_005 1102 3UTR 100% 10.800 15.120 N ANXA13 n/a
2 TRCN0000056470 CCTATTTAACTCTCGTGAGAT pLKO.1 763 CDS 100% 4.950 6.930 N ANXA13 n/a
3 TRCN0000380669 GACTTGCAGAAGGCCTATTTA pLKO_005 750 CDS 100% 15.000 10.500 N ANXA13 n/a
4 TRCN0000382368 CACCTTTCAAGCCTATCAAAT pLKO_005 680 CDS 100% 13.200 9.240 N ANXA13 n/a
5 TRCN0000056472 CCCAGGATTGTGAGGACTATT pLKO.1 787 CDS 100% 13.200 9.240 N ANXA13 n/a
6 TRCN0000289666 CCCAGGATTGTGAGGACTATT pLKO_005 787 CDS 100% 13.200 9.240 N ANXA13 n/a
7 TRCN0000056471 GCAAAGTTCCAAGAGAAGTAT pLKO.1 912 CDS 100% 5.625 3.938 N ANXA13 n/a
8 TRCN0000289665 GCAAAGTTCCAAGAGAAGTAT pLKO_005 912 CDS 100% 5.625 3.938 N ANXA13 n/a
9 TRCN0000056469 GCAGCCATCATTGAAATCTTA pLKO.1 162 CDS 100% 5.625 3.938 N ANXA13 n/a
10 TRCN0000333144 GCAGCCATCATTGAAATCTTA pLKO_005 162 CDS 100% 5.625 3.938 N ANXA13 n/a
11 TRCN0000056468 CGCCTTTGTCAAGAGCACATT pLKO.1 1045 3UTR 100% 4.950 3.465 N ANXA13 n/a
12 TRCN0000307101 CGCCTTTGTCAAGAGCACATT pLKO_005 1045 3UTR 100% 4.950 3.465 N ANXA13 n/a
13 TRCN0000381988 ATCAGATGAGAGGCAACAAAT pLKO_005 194 CDS 100% 13.200 7.920 N ANXA13 n/a
14 TRCN0000381752 CTGATGAGCTTGCGTTCAATG pLKO_005 622 CDS 100% 10.800 6.480 N ANXA13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004306.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05827 pDONR223 100% 99.7% 99.3% None 257G>A;814G>A n/a
2 ccsbBroad304_05827 pLX_304 0% 99.7% 99.3% V5 257G>A;814G>A n/a
3 TRCN0000475407 GAGGTACGTGATGTCCGAGGATCC pLX_317 51.2% 99.7% 99.3% V5 257G>A;814G>A n/a
Download CSV