Transcript: Human NM_004450.3

Homo sapiens ERH mRNA splicing and mitosis factor (ERH), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ERH (2079)
Length:
791
CDS:
67..381

Additional Resources:

NCBI RefSeq record:
NM_004450.3
NBCI Gene record:
ERH (2079)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004450.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107720 CCAGTCCTTCAACTGTTCATA pLKO.1 650 3UTR 100% 5.625 4.500 N ERH n/a
2 TRCN0000300267 CCAGTCCTTCAACTGTTCATA pLKO_005 650 3UTR 100% 5.625 4.500 N ERH n/a
3 TRCN0000107721 CCTTATAACAAAGACTGGATT pLKO.1 307 CDS 100% 4.950 3.960 N ERH n/a
4 TRCN0000107723 CCCAGACATACCAGCCTTATA pLKO.1 293 CDS 100% 13.200 9.240 N ERH n/a
5 TRCN0000300268 CCCAGACATACCAGCCTTATA pLKO_005 293 CDS 100% 13.200 9.240 N ERH n/a
6 TRCN0000107722 GCCTGGTTTACCGAGCTGATA pLKO.1 272 CDS 100% 4.950 3.465 N ERH n/a
7 TRCN0000300269 GCCTGGTTTACCGAGCTGATA pLKO_005 272 CDS 100% 4.950 3.465 N ERH n/a
8 TRCN0000107724 GCTGACTACGAATCTGTGAAT pLKO.1 124 CDS 100% 4.950 3.465 N ERH n/a
9 TRCN0000300270 GCTGACTACGAATCTGTGAAT pLKO_005 124 CDS 100% 4.950 3.465 N ERH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004450.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00515 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00515 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470059 CAAATAGACCACTTGCACTGCATC pLX_317 100% 100% 100% V5 n/a
Download CSV