Transcript: Human NM_004452.3

Homo sapiens estrogen related receptor beta (ESRRB), mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
ESRRB (2103)
Length:
3029
CDS:
372..1898

Additional Resources:

NCBI RefSeq record:
NM_004452.3
NBCI Gene record:
ESRRB (2103)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004452.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022204 CGCTTCATGAAATGCCTCAAA pLKO.1 846 CDS 100% 4.950 6.930 N ESRRB n/a
2 TRCN0000420154 GGACTATCCAAGGGAACATTG pLKO_005 757 CDS 100% 10.800 8.640 N ESRRB n/a
3 TRCN0000022206 CCCATACCTGAGCTTACAAAT pLKO.1 953 CDS 100% 13.200 9.240 N ESRRB n/a
4 TRCN0000421034 GTGGAACAGATCTCAAGTTTA pLKO_005 2278 3UTR 100% 13.200 9.240 N ESRRB n/a
5 TRCN0000421077 AGCACTTCTATAGCGTCAAAC pLKO_005 1594 CDS 100% 10.800 7.560 N ESRRB n/a
6 TRCN0000420040 GGTGAAGTGAGGAGAGTTTAG pLKO_005 2242 3UTR 100% 10.800 7.560 N ESRRB n/a
7 TRCN0000022208 CGAGAGCTTGTGGTCATCATT pLKO.1 1116 CDS 100% 5.625 3.938 N ESRRB n/a
8 TRCN0000022205 GCACAAACTCTTCCTGGAGAT pLKO.1 1634 CDS 100% 4.050 2.835 N ESRRB n/a
9 TRCN0000022207 GCTGAGGACTACATCATGGAT pLKO.1 1275 CDS 100% 3.000 1.800 N ESRRB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004452.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489168 TTGATCATTCCCATAATGTACCAA pLX_317 26.5% 90.3% 83.4% V5 (many diffs) n/a
2 TRCN0000489270 CTGTCCTGCGTCAGACCGGACGCC pLX_317 26.6% 90.3% 83.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV