Transcript: Human NM_004454.3

Homo sapiens ETS variant transcription factor 5 (ETV5), mRNA.

Source:
NCBI, updated 2019-07-26
Taxon:
Homo sapiens (human)
Gene:
ETV5 (2119)
Length:
4082
CDS:
225..1757

Additional Resources:

NCBI RefSeq record:
NM_004454.3
NBCI Gene record:
ETV5 (2119)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273931 GAGCGATACGTCTACAAATTT pLKO_005 1545 CDS 100% 15.000 21.000 N ETV5 n/a
2 TRCN0000013940 CTCTACAACTATTGTGCCTAT pLKO.1 573 CDS 100% 4.050 5.670 N ETV5 n/a
3 TRCN0000312867 AGCTTGCCCTTTGAGTATTAT pLKO_005 1854 3UTR 100% 15.000 12.000 N Etv5 n/a
4 TRCN0000013942 CGGCAAATGTCAGAACCTATT pLKO.1 957 CDS 100% 10.800 8.640 N ETV5 n/a
5 TRCN0000013938 CCGTGACACTTAGTACATTAA pLKO.1 3264 3UTR 100% 13.200 9.240 N ETV5 n/a
6 TRCN0000273930 CCGTGACACTTAGTACATTAA pLKO_005 3264 3UTR 100% 13.200 9.240 N ETV5 n/a
7 TRCN0000273974 CACCTCCAACCAAGATCAAAC pLKO_005 472 CDS 100% 10.800 7.560 N ETV5 n/a
8 TRCN0000273929 TCCATGGCTTTCCCGGATAAC pLKO_005 1590 CDS 100% 10.800 7.560 N ETV5 n/a
9 TRCN0000013939 CTCACGATTCTGAAGAGCTAT pLKO.1 343 CDS 100% 4.950 3.465 N ETV5 n/a
10 TRCN0000054787 GCCAGCCATGAACTATGACAA pLKO.1 1466 CDS 100% 4.950 3.465 N Etv5 n/a
11 TRCN0000013941 CTTCTTGATGACCCAGCCAAT pLKO.1 1353 CDS 100% 4.050 2.835 N ETV5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00521 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00521 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467138 TTCGAGCCTGTGGTCAGAATCACT pLX_317 26.9% 100% 100% V5 n/a
Download CSV