Transcript: Human NM_004463.3

Homo sapiens FYVE, RhoGEF and PH domain containing 1 (FGD1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FGD1 (2245)
Length:
4343
CDS:
803..3688

Additional Resources:

NCBI RefSeq record:
NM_004463.3
NBCI Gene record:
FGD1 (2245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004463.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293712 GAGCGCTCCACCCAGTTTAAA pLKO_005 2258 CDS 100% 15.000 21.000 N FGD1 n/a
2 TRCN0000048169 CCACGGCATCTTCTCTAACAT pLKO.1 2056 CDS 100% 5.625 7.875 N FGD1 n/a
3 TRCN0000048171 CCGATACCTCATACTATTCAA pLKO.1 2629 CDS 100% 5.625 7.875 N FGD1 n/a
4 TRCN0000286398 CCGATACCTCATACTATTCAA pLKO_005 2629 CDS 100% 5.625 7.875 N FGD1 n/a
5 TRCN0000048172 CCTGTGATTGTCGCCTCGGAT pLKO.1 1466 CDS 100% 0.880 1.232 N FGD1 n/a
6 TRCN0000286397 CCTGTGATTGTCGCCTCGGAT pLKO_005 1466 CDS 100% 0.880 1.232 N FGD1 n/a
7 TRCN0000110024 GCAAAGAATGGGACCACTCAA pLKO.1 2606 CDS 100% 4.950 3.960 N Fgd1 n/a
8 TRCN0000293711 TTGCCAGTCCTACCTGAATTA pLKO_005 3934 3UTR 100% 13.200 9.240 N FGD1 n/a
9 TRCN0000048170 GCTGAAGGTATATGAGCTGTT pLKO.1 2515 CDS 100% 4.050 2.835 N FGD1 n/a
10 TRCN0000048168 GCCCTTCAATTCTATCACCAA pLKO.1 3025 CDS 100% 2.640 1.848 N FGD1 n/a
11 TRCN0000286339 GCCCTTCAATTCTATCACCAA pLKO_005 3025 CDS 100% 2.640 1.848 N FGD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004463.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.