Transcript: Human NM_004466.6

Homo sapiens glypican 5 (GPC5), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GPC5 (2262)
Length:
2943
CDS:
427..2145

Additional Resources:

NCBI RefSeq record:
NM_004466.6
NBCI Gene record:
GPC5 (2262)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004466.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372372 ACCTTACTGAAGTCTCGATTT pLKO_005 2168 3UTR 100% 10.800 15.120 N GPC5 n/a
2 TRCN0000147200 CGGATGTTAATCCTGAAGAAT pLKO.1 890 CDS 100% 5.625 7.875 N GPC5 n/a
3 TRCN0000179644 GCCTGGAATAAGAGATCCTTT pLKO.1 2206 3UTR 100% 4.950 3.960 N GPC5 n/a
4 TRCN0000427284 GGAATTGATCCTGTGATAAAT pLKO_005 1774 CDS 100% 15.000 10.500 N GPC5 n/a
5 TRCN0000378703 GTGAGTCCATTTGGTAATATT pLKO_005 1027 CDS 100% 15.000 10.500 N GPC5 n/a
6 TRCN0000147993 GCACAGAAGTGACTTTGAATA pLKO.1 2409 3UTR 100% 13.200 9.240 N GPC5 n/a
7 TRCN0000183222 GCAAGTAGTATGCATGCATAT pLKO.1 2598 3UTR 100% 10.800 7.560 N GPC5 n/a
8 TRCN0000372373 GCGACTGAATCTATGACATTC pLKO_005 2083 CDS 100% 10.800 7.560 N GPC5 n/a
9 TRCN0000109542 GCGAAGAAGTTCGGAAACTTT pLKO.1 515 CDS 100% 0.563 0.394 N Gpc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004466.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00562 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00562 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465883 CTCAAGAGTACCAACAATTCGGTT pLX_317 17.9% 100% 100% V5 n/a
Download CSV