Transcript: Human NM_004473.4

Homo sapiens forkhead box E1 (FOXE1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
FOXE1 (2304)
Length:
3492
CDS:
690..1811

Additional Resources:

NCBI RefSeq record:
NM_004473.4
NBCI Gene record:
FOXE1 (2304)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004473.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425190 TAACTGCGTTACTACAATAAA pLKO_005 2226 3UTR 100% 15.000 10.500 N FOXE1 n/a
2 TRCN0000427475 ACGGGATGCTTTCTGGTATTC pLKO_005 2060 3UTR 100% 10.800 7.560 N FOXE1 n/a
3 TRCN0000015468 GCCCAGTCATAAATCTGCTTT pLKO.1 2729 3UTR 100% 4.950 3.465 N FOXE1 n/a
4 TRCN0000423396 AGTGCGATCTTTGCCGCTGCT pLKO_005 1569 CDS 100% 0.720 0.504 N FOXE1 n/a
5 TRCN0000015471 CATCTACAAGTTCATCACCGA pLKO.1 923 CDS 100% 0.660 0.462 N FOXE1 n/a
6 TRCN0000015470 CCTCTCCACCTACCCGGCTTA pLKO.1 1148 CDS 100% 0.000 0.000 N FOXE1 n/a
7 TRCN0000015472 CGTGGAGACCACGGTGGACTT pLKO.1 1640 CDS 100% 0.000 0.000 N FOXE1 n/a
8 TRCN0000015469 GCCGCTTATCCCGGTGGGATA pLKO.1 1767 CDS 100% 0.000 0.000 N FOXE1 n/a
9 TRCN0000017867 GCAGAACAGCATCCGCCACAA pLKO.1 980 CDS 100% 1.350 0.675 Y FOXD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004473.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.