Transcript: Human NM_004522.3

Homo sapiens kinesin family member 5C (KIF5C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
KIF5C (3800)
Length:
6954
CDS:
392..3265

Additional Resources:

NCBI RefSeq record:
NM_004522.3
NBCI Gene record:
KIF5C (3800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004522.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245800 CTCTTATTGCTCAACGATAAA pLKO_005 2699 CDS 100% 13.200 18.480 N KIF5C n/a
2 TRCN0000245801 GATCTGACCACCCGAGTTAAA pLKO_005 2813 CDS 100% 13.200 18.480 N KIF5C n/a
3 TRCN0000245798 TCCAGACTCCGAGACGAAATT pLKO_005 2546 CDS 100% 13.200 18.480 N KIF5C n/a
4 TRCN0000245799 TATACCTGCTCTACCATTATT pLKO_005 5013 3UTR 100% 15.000 10.500 N KIF5C n/a
5 TRCN0000245802 GATGTCCTTGAAGGTTATAAC pLKO_005 608 CDS 100% 13.200 9.240 N KIF5C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004522.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13887 pDONR223 100% 75.1% 75.1% None (many diffs) n/a
2 ccsbBroad304_13887 pLX_304 0% 75.1% 75.1% V5 (many diffs) n/a
3 TRCN0000477266 TAGACTGAGATACTATTTATCGAA pLX_317 14.1% 75.1% 75.1% V5 (many diffs) n/a
Download CSV