Transcript: Human NM_004531.5

Homo sapiens molybdenum cofactor synthesis 2 (MOCS2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MOCS2 (4338)
Length:
4166
CDS:
677..1243

Additional Resources:

NCBI RefSeq record:
NM_004531.5
NBCI Gene record:
MOCS2 (4338)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004531.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045687 TGAGCCATCTAGGAAAGATAT pLKO.1 763 CDS 100% 13.200 9.240 N MOCS2 n/a
2 TRCN0000291649 TGAGCCATCTAGGAAAGATAT pLKO_005 763 CDS 100% 13.200 9.240 N MOCS2 n/a
3 TRCN0000045685 GCTGTGAGCTATGCCATTGAT pLKO.1 1124 CDS 100% 5.625 3.938 N MOCS2 n/a
4 TRCN0000291650 GCTGTGAGCTATGCCATTGAT pLKO_005 1124 CDS 100% 5.625 3.938 N MOCS2 n/a
5 TRCN0000045684 CCAGTGTCAGAAGCAAGCATA pLKO.1 1061 CDS 100% 4.950 3.465 N MOCS2 n/a
6 TRCN0000291712 CCAGTGTCAGAAGCAAGCATA pLKO_005 1061 CDS 100% 4.950 3.465 N MOCS2 n/a
7 TRCN0000045683 CCCTATTTGTAGGGACTACAA pLKO.1 891 CDS 100% 0.495 0.347 N MOCS2 n/a
8 TRCN0000291640 CCCTATTTGTAGGGACTACAA pLKO_005 891 CDS 100% 0.495 0.347 N MOCS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004531.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01028 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01028 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465930 TAACAAAGATGTCATATTTCTGAA pLX_317 65.2% 100% 100% V5 n/a
Download CSV