Transcript: Human NM_004547.6

Homo sapiens NADH:ubiquinone oxidoreductase subunit B4 (NDUFB4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
NDUFB4 (4710)
Length:
651
CDS:
25..414

Additional Resources:

NCBI RefSeq record:
NM_004547.6
NBCI Gene record:
NDUFB4 (4710)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004547.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240321 GGCCTATGCAAGAACAATAAA pLKO_005 228 CDS 100% 15.000 21.000 N NDUFB4 n/a
2 TRCN0000240325 ACCCAGCCGAATACAACATAT pLKO_005 80 CDS 100% 13.200 18.480 N NDUFB4 n/a
3 TRCN0000028455 CCAGCCGAATACAACATATCT pLKO.1 82 CDS 100% 5.625 7.875 N NDUFB4 n/a
4 TRCN0000028444 GAATACAACATATCTCCGGAA pLKO.1 88 CDS 100% 2.160 3.024 N NDUFB4 n/a
5 TRCN0000028434 GCTTCAGTACAACGATCCCAA pLKO.1 168 CDS 100% 2.640 2.112 N NDUFB4 n/a
6 TRCN0000028450 GCCTATGCAAGAACAATAAAT pLKO.1 229 CDS 100% 15.000 10.500 N NDUFB4 n/a
7 TRCN0000240323 TATGTATTCCTGCCTAAATAA pLKO_005 433 3UTR 100% 15.000 10.500 N NDUFB4 n/a
8 TRCN0000240322 CGAACATTTCACCTCTCATAT pLKO_005 391 CDS 100% 13.200 9.240 N NDUFB4 n/a
9 TRCN0000240324 ATGGGAGCTCTGTGTGGATTT pLKO_005 289 CDS 100% 10.800 7.560 N NDUFB4 n/a
10 TRCN0000028483 CTGAAACGAGAGTACCTGCTT pLKO.1 151 CDS 100% 2.640 1.848 N NDUFB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004547.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.