Transcript: Human NM_004585.5

Homo sapiens phospholipase A and acyltransferase 4 (PLAAT4), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PLAAT4 (5920)
Length:
758
CDS:
62..556

Additional Resources:

NCBI RefSeq record:
NM_004585.5
NBCI Gene record:
PLAAT4 (5920)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004585.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358981 TATGGCAAGTCCCGCTGTAAA pLKO_005 425 CDS 100% 13.200 18.480 N PLAAT4 n/a
2 TRCN0000063491 GCGCTTGGAATCCTGGTTGTT pLKO.1 485 CDS 100% 4.950 6.930 N PLAAT4 n/a
3 TRCN0000358979 TTGCGATTAGGAGATACCAAA pLKO_005 519 CDS 100% 4.950 6.930 N PLAAT4 n/a
4 TRCN0000063490 CTGTTGCTATCGGGTCAACAA pLKO.1 274 CDS 100% 0.495 0.693 N PLAAT4 n/a
5 TRCN0000359061 GAGCACTGGGCCCTGTATATA pLKO_005 125 CDS 100% 15.000 10.500 N PLAAT4 n/a
6 TRCN0000359063 GCAACAGTGCAGAGGTGAAAC pLKO_005 225 CDS 100% 10.800 7.560 N PLAAT4 n/a
7 TRCN0000063489 CCTGTATATAGGAGATGGCTA pLKO.1 136 CDS 100% 2.640 1.848 N PLAAT4 n/a
8 TRCN0000063492 GTACAGTATTGTGAGCAGGAA pLKO.1 376 CDS 100% 2.640 1.848 N PLAAT4 n/a
9 TRCN0000063488 CCCGCTGTAAACAGGTGGAAA pLKO.1 435 CDS 100% 4.950 2.970 N PLAAT4 n/a
10 TRCN0000156274 CCTGGAGACCTGATTGAGATT pLKO.1 89 CDS 100% 4.950 2.475 Y PLAAT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004585.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06845 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_06845 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468225 TTCACTTTGCTCGCTTAATGCAGC pLX_317 80.6% 100% 100% V5 n/a
Download CSV