Transcript: Human NM_004589.4

Homo sapiens SCO cytochrome c oxidase assembly protein 1 (SCO1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SCO1 (6341)
Length:
9577
CDS:
27..932

Additional Resources:

NCBI RefSeq record:
NM_004589.4
NBCI Gene record:
SCO1 (6341)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004589.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046039 CGTGGATGAAATAGATAGCAT pLKO.1 575 CDS 100% 3.000 4.200 N SCO1 n/a
2 TRCN0000293944 TCTCGCATAGGAGCCTATATA pLKO_005 985 3UTR 100% 15.000 12.000 N SCO1 n/a
3 TRCN0000046040 GCCATCGCAAATTATGTGAAA pLKO.1 660 CDS 100% 4.950 3.960 N SCO1 n/a
4 TRCN0000298233 GCCATCGCAAATTATGTGAAA pLKO_005 660 CDS 100% 4.950 3.960 N SCO1 n/a
5 TRCN0000293899 CTACTTGGGTCAGTGGTTATT pLKO_005 488 CDS 100% 13.200 9.240 N SCO1 n/a
6 TRCN0000046042 GACGAAGATGAAGACTACATA pLKO.1 777 CDS 100% 5.625 3.938 N SCO1 n/a
7 TRCN0000046041 GAAGTCTTTAGCAATCACATT pLKO.1 311 CDS 100% 4.950 3.465 N SCO1 n/a
8 TRCN0000286534 GAAGTCTTTAGCAATCACATT pLKO_005 311 CDS 100% 4.950 3.465 N SCO1 n/a
9 TRCN0000046038 GCCAGAGCATACAGAGTGTAT pLKO.1 738 CDS 100% 4.950 3.465 N SCO1 n/a
10 TRCN0000293900 TGGTGAGTTTCTAGATTATTT pLKO_005 836 CDS 100% 15.000 9.000 N SCO1 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2824 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4174 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4174 3UTR 100% 5.625 2.813 Y EID2B n/a
14 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2992 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004589.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01493 pDONR223 100% 100% 100% None n/a
2 TRCN0000480160 GCATGCGTTAGAAGCGTTCGTTGA pLX_317 43.8% 100% 100% V5 n/a
Download CSV