Transcript: Human NM_004706.4

Homo sapiens Rho guanine nucleotide exchange factor 1 (ARHGEF1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ARHGEF1 (9138)
Length:
3229
CDS:
126..2864

Additional Resources:

NCBI RefSeq record:
NM_004706.4
NBCI Gene record:
ARHGEF1 (9138)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004706.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437366 ACCCTATGCTGAGCGAGTTCA pLKO_005 2020 CDS 100% 4.950 6.930 N ARHGEF1 n/a
2 TRCN0000033567 CACCGATCACAAAGCCTTCTA pLKO.1 2282 CDS 100% 4.950 6.930 N ARHGEF1 n/a
3 TRCN0000033566 CCATCTCTACCGACGAAGAAA pLKO.1 745 CDS 100% 5.625 3.938 N ARHGEF1 n/a
4 TRCN0000033568 TCCCTGAAGCAGCTTCTGTTT pLKO.1 2622 CDS 100% 4.950 3.465 N ARHGEF1 n/a
5 TRCN0000437442 TGTTCCTCGATCGCCTGATGA pLKO_005 1543 CDS 100% 4.950 3.465 N ARHGEF1 n/a
6 TRCN0000033564 CCTTTGAACTTGACCGCACTA pLKO.1 481 CDS 100% 4.050 2.835 N ARHGEF1 n/a
7 TRCN0000422080 GGAAATTCTACACCACGTCAA pLKO_005 1913 CDS 100% 4.050 2.835 N ARHGEF1 n/a
8 TRCN0000444419 TTGCTGTCTGCATGCCGACAT pLKO_005 353 CDS 100% 4.050 2.835 N ARHGEF1 n/a
9 TRCN0000033565 CATGGCAGAATGCCTGTTCTT pLKO.1 1460 CDS 100% 4.950 2.970 N ARHGEF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004706.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15657 pDONR223 0% 96.3% 96.3% None 225_323del n/a
2 ccsbBroad304_15657 pLX_304 0% 96.3% 96.3% V5 225_323del n/a
Download CSV