Transcript: Human NM_004738.5

Homo sapiens VAMP associated protein B and C (VAPB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
VAPB (9217)
Length:
7829
CDS:
232..963

Additional Resources:

NCBI RefSeq record:
NM_004738.5
NBCI Gene record:
VAPB (9217)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004738.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381269 GAAACACCAATAGTGTCTAAG pLKO_005 676 CDS 100% 10.800 8.640 N VAPB n/a
2 TRCN0000381294 TGTTGTCACCACCAACCTAAA pLKO_005 303 CDS 100% 10.800 8.640 N VAPB n/a
3 TRCN0000152273 CGAAGTTAAGAAGGTTATGGA pLKO.1 723 CDS 100% 3.000 2.400 N VAPB n/a
4 TRCN0000152888 GCCTTTCGATTATGATCCCAA pLKO.1 453 CDS 100% 2.640 2.112 N VAPB n/a
5 TRCN0000382043 ATGTTACAGCCTTTCGATTAT pLKO_005 445 CDS 100% 13.200 9.240 N VAPB n/a
6 TRCN0000152239 CCAGTTCTGTTTGACTATGTA pLKO.1 2216 3UTR 100% 5.625 3.938 N VAPB n/a
7 TRCN0000292369 CCAGTTCTGTTTGACTATGTA pLKO_005 2216 3UTR 100% 5.625 3.938 N VAPB n/a
8 TRCN0000093627 CGGAAGACCTTATGGATTCAA pLKO.1 563 CDS 100% 5.625 3.938 N Vapb n/a
9 TRCN0000153862 CGGAAGACCTTATGGATTCAA pLKO.1 563 CDS 100% 5.625 3.938 N VAPB n/a
10 TRCN0000292310 CGGAAGACCTTATGGATTCAA pLKO_005 563 CDS 100% 5.625 3.938 N VAPB n/a
11 TRCN0000150709 CGATTATGATCCCAATGAGAA pLKO.1 459 CDS 100% 4.950 3.465 N VAPB n/a
12 TRCN0000152520 GACAGACCGAAATGTGTGTTT pLKO.1 336 CDS 100% 4.950 3.465 N VAPB n/a
13 TRCN0000292368 GACAGACCGAAATGTGTGTTT pLKO_005 336 CDS 100% 4.950 3.465 N VAPB n/a
14 TRCN0000093625 CCTTTCGATTATGATCCCAAT pLKO.1 454 CDS 100% 4.050 2.835 N Vapb n/a
15 TRCN0000153562 GAGAACAAGCAGTTCAAGGAA pLKO.1 787 CDS 100% 3.000 2.100 N VAPB n/a
16 TRCN0000156377 CCTTGGTACATGATGCTGGAT pLKO.1 1273 3UTR 100% 2.640 1.848 N VAPB n/a
17 TRCN0000153172 GAAGAATGTAAGAGGCTGCAA pLKO.1 742 CDS 100% 2.640 1.848 N VAPB n/a
18 TRCN0000151599 GCAGAGAATGATAAACCACAT pLKO.1 610 CDS 100% 4.050 2.430 N VAPB n/a
19 TRCN0000344042 GCAGAGAATGATAAACCACAT pLKO_005 610 CDS 100% 4.050 2.430 N VAPB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004738.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02110 pDONR223 100% 97.9% 97.9% None 715_729del n/a
2 ccsbBroad304_02110 pLX_304 0% 97.9% 97.9% V5 715_729del n/a
3 TRCN0000465325 TTTCGGCACTACCTGGTCAGCATA pLX_317 51.1% 97.9% 97.9% V5 715_729del n/a
Download CSV