Transcript: Human NM_004758.4

Homo sapiens TSPO associated protein 1 (TSPOAP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
TSPOAP1 (9256)
Length:
7698
CDS:
876..6449

Additional Resources:

NCBI RefSeq record:
NM_004758.4
NBCI Gene record:
TSPOAP1 (9256)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061567 CCTAGCACGTTATAGCTACAA pLKO.1 2849 CDS 100% 4.950 6.930 N TSPOAP1 n/a
2 TRCN0000061564 CGGCTTCCATATCTGTGTGAA pLKO.1 3338 CDS 100% 4.950 3.960 N TSPOAP1 n/a
3 TRCN0000418079 GGTGAAGGTCAGAGCTAAATG pLKO_005 6807 3UTR 100% 13.200 9.240 N TSPOAP1 n/a
4 TRCN0000429644 ACGATGACGGTTTCTACTATG pLKO_005 6289 CDS 100% 10.800 7.560 N TSPOAP1 n/a
5 TRCN0000435343 AGCTGAGACAAGCGCAGAATG pLKO_005 1987 CDS 100% 10.800 7.560 N TSPOAP1 n/a
6 TRCN0000424379 GCCGACTTCTCAGCAACAATG pLKO_005 5161 CDS 100% 10.800 7.560 N TSPOAP1 n/a
7 TRCN0000061563 GCTTGGAAATCAGCATTGAAT pLKO.1 5356 CDS 100% 5.625 3.938 N TSPOAP1 n/a
8 TRCN0000061566 CCAGCAGTTCTGTAGCAAGAA pLKO.1 4838 CDS 100% 4.950 3.465 N TSPOAP1 n/a
9 TRCN0000061565 CCCGTGTCAATGTCGCCCAAT pLKO.1 5787 CDS 100% 1.350 0.945 N TSPOAP1 n/a
10 TRCN0000202248 GTTCCATCCAACTTCCTGGAA pLKO.1 6336 CDS 100% 0.264 0.185 N Tspoap1 n/a
11 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 4657 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07380 pDONR223 100% 99.9% 99.9% None 4344G>A;5361G>T n/a
2 ccsbBroad304_07380 pLX_304 0% 99.9% 99.9% V5 4344G>A;5361G>T n/a
3 TRCN0000476460 GCCAATGTTAGAGGTTTTTAATTC pLX_317 6.9% 99.9% 99.9% V5 4344G>A;5361G>T n/a
Download CSV