Transcript: Human NM_004782.4

Homo sapiens synaptosome associated protein 29 (SNAP29), mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
SNAP29 (9342)
Length:
4259
CDS:
105..881

Additional Resources:

NCBI RefSeq record:
NM_004782.4
NBCI Gene record:
SNAP29 (9342)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004782.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231850 GAAGCTATAAGTACAAGTAAA pLKO_005 546 CDS 100% 13.200 18.480 N SNAP29 n/a
2 TRCN0000380453 GGCTGGTCAATTACTTCAAAT pLKO_005 457 CDS 100% 13.200 10.560 N SNAP29 n/a
3 TRCN0000231853 TTAGGACTGGCACTCTATAAA pLKO_005 1918 3UTR 100% 15.000 10.500 N SNAP29 n/a
4 TRCN0000231851 ACAAGTTAGATGTCAACATAA pLKO_005 829 CDS 100% 13.200 9.240 N SNAP29 n/a
5 TRCN0000231849 ATAGCATTAAGAGCGTGTTTG pLKO_005 433 CDS 100% 10.800 7.560 N SNAP29 n/a
6 TRCN0000231852 CTCTGAAGACAGACGGATTTC pLKO_005 876 CDS 100% 10.800 7.560 N SNAP29 n/a
7 TRCN0000083651 ACAACCAAAGTGGACAAGTTA pLKO.1 816 CDS 100% 5.625 3.938 N SNAP29 n/a
8 TRCN0000083649 CCCAACAACAGATTGAAAGAA pLKO.1 528 CDS 100% 5.625 3.938 N SNAP29 n/a
9 TRCN0000083648 GCACATTATCTGTGATTCTTT pLKO.1 1409 3UTR 100% 5.625 3.938 N SNAP29 n/a
10 TRCN0000381551 GGTTCTGCCATGAGTACTGAT pLKO_005 645 CDS 100% 4.950 3.465 N SNAP29 n/a
11 TRCN0000083650 CCAGAAACACATCAATAGCAT pLKO.1 419 CDS 100% 3.000 2.100 N SNAP29 n/a
12 TRCN0000083652 CAGACAGAAATTGAGGAGCAA pLKO.1 774 CDS 100% 2.640 1.848 N SNAP29 n/a
13 TRCN0000380505 GCAGCCATGAGCCTCTATTTC pLKO_005 1233 3UTR 100% 13.200 7.920 N SNAP29 n/a
14 TRCN0000379796 CCTTAGAAAGCTGGATGATAC pLKO_005 602 CDS 100% 10.800 6.480 N SNAP29 n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1357 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004782.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07394 pDONR223 100% 99.8% 100% None 18A>G n/a
2 ccsbBroad304_07394 pLX_304 0% 99.8% 100% V5 18A>G n/a
3 TRCN0000467812 CCAACCCGTGCTGGAGCACAATGC pLX_317 52% 99.8% 100% V5 18A>G n/a
Download CSV