Transcript: Human NM_004867.5

Homo sapiens integral membrane protein 2A (ITM2A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ITM2A (9452)
Length:
1616
CDS:
120..911

Additional Resources:

NCBI RefSeq record:
NM_004867.5
NBCI Gene record:
ITM2A (9452)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004867.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416135 ACCTAACATCCTGACAATAAA pLKO_005 1189 3UTR 100% 15.000 21.000 N ITM2A n/a
2 TRCN0000418434 ATAGAGTGTCCTTGGTAATAA pLKO_005 922 3UTR 100% 15.000 21.000 N ITM2A n/a
3 TRCN0000117895 GAGATGTATGCTTACTCTCTT pLKO.1 272 CDS 100% 4.950 6.930 N ITM2A n/a
4 TRCN0000117893 CCCTCAATACTTCTATTGTTA pLKO.1 610 CDS 100% 0.563 0.788 N ITM2A n/a
5 TRCN0000429772 AGATATCTGCCTCAAACTTAT pLKO_005 678 CDS 100% 13.200 9.240 N ITM2A n/a
6 TRCN0000418094 GTGACCCTGCAGCAATTATTC pLKO_005 526 CDS 100% 13.200 9.240 N ITM2A n/a
7 TRCN0000429787 ACTCATGCATTTACTCTATTG pLKO_005 1003 3UTR 100% 10.800 7.560 N ITM2A n/a
8 TRCN0000117894 CCTCTGGGAGATGTATGCTTA pLKO.1 265 CDS 100% 4.950 3.465 N ITM2A n/a
9 TRCN0000117896 GTGGAGGAAATTCGTGATGTT pLKO.1 723 CDS 100% 4.950 3.465 N ITM2A n/a
10 TRCN0000117892 CCTGACTTATATGTGAACAAT pLKO.1 1444 3UTR 100% 5.625 3.375 N ITM2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004867.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02167 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02167 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468434 GTTTTATTCCGCCCGTACGACTTG pLX_317 59.7% 100% 100% V5 n/a
Download CSV