Transcript: Human NM_004879.5

Homo sapiens EI24 autophagy associated transmembrane protein (EI24), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
EI24 (9538)
Length:
2191
CDS:
168..1190

Additional Resources:

NCBI RefSeq record:
NM_004879.5
NBCI Gene record:
EI24 (9538)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004879.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427903 GTAATTCTAGCTGTTGTATTT pLKO_005 1559 3UTR 100% 13.200 10.560 N EI24 n/a
2 TRCN0000159966 CGAGTATTTATTCCTGTGCTT pLKO.1 438 CDS 100% 2.640 2.112 N EI24 n/a
3 TRCN0000159876 GCCATTTGGTTTCAGGATATA pLKO.1 594 CDS 100% 13.200 9.240 N EI24 n/a
4 TRCN0000413756 CAAGAGAGTGAGCCACGTATT pLKO_005 348 CDS 100% 10.800 7.560 N EI24 n/a
5 TRCN0000425760 GGAATTGGCCTTACTACTTTG pLKO_005 877 CDS 100% 10.800 7.560 N EI24 n/a
6 TRCN0000162640 CCCTTGTTTGTGCTTAGCAAA pLKO.1 564 CDS 100% 4.950 3.465 N EI24 n/a
7 TRCN0000162907 GAGATGGCTGACAGTGTCAAA pLKO.1 165 5UTR 100% 4.950 3.465 N EI24 n/a
8 TRCN0000160559 CAAAGCATATCTCTTCCAGTT pLKO.1 1019 CDS 100% 4.050 2.835 N EI24 n/a
9 TRCN0000163050 GCTGACATGCTCTTCAACCTT pLKO.1 681 CDS 100% 3.000 2.100 N EI24 n/a
10 TRCN0000127315 CCACGTATTGTTAGTAGAATT pLKO.1 360 CDS 100% 0.000 0.000 N Ei24 n/a
11 TRCN0000312159 CCACGTATTGTTAGTAGAATT pLKO_005 360 CDS 100% 0.000 0.000 N Ei24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004879.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02191 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02191 pLX_304 0% 100% 100% V5 n/a
Download CSV