Transcript: Human NM_004950.5

Homo sapiens epiphycan (EPYC), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
EPYC (1833)
Length:
1482
CDS:
40..1008

Additional Resources:

NCBI RefSeq record:
NM_004950.5
NBCI Gene record:
EPYC (1833)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004950.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158054 CTGCCAAAGAACACCGCTTAT pLKO.1 460 CDS 100% 10.800 15.120 N EPYC n/a
2 TRCN0000157581 GCACGAAGATACGTTCTGCAA pLKO.1 858 CDS 100% 2.640 3.696 N EPYC n/a
3 TRCN0000153919 CTAGAGGACATTCGATTGGAT pLKO.1 910 CDS 100% 3.000 2.400 N EPYC n/a
4 TRCN0000372197 TTGCAAGCCTAAGTGATTTAA pLKO_005 527 CDS 100% 15.000 10.500 N EPYC n/a
5 TRCN0000372142 GCATTACGATGGCTACTATAA pLKO_005 1025 3UTR 100% 13.200 9.240 N EPYC n/a
6 TRCN0000156455 CCACCTTAGAAGACCTGGATA pLKO.1 143 CDS 100% 4.950 3.465 N EPYC n/a
7 TRCN0000150538 GATTGTGTTCTGAGAGATGAT pLKO.1 1099 3UTR 100% 4.950 3.465 N EPYC n/a
8 TRCN0000151219 GACATGTATGATCTCCATCAT pLKO.1 742 CDS 100% 0.495 0.347 N EPYC n/a
9 TRCN0000372199 CTCTAGAGTCCATCAACTATG pLKO_005 104 CDS 100% 10.800 6.480 N EPYC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004950.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06127 pDONR223 100% 99.8% 99.6% None 155A>G n/a
2 ccsbBroad304_06127 pLX_304 0% 99.8% 99.6% V5 155A>G n/a
3 TRCN0000475490 TGTCGATCGAGATACATGGTCGCC pLX_317 42% 99.8% 99.6% V5 155A>G n/a
Download CSV