Transcript: Human NM_005088.3

Homo sapiens A-kinase anchoring protein 17A (AKAP17A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
AKAP17A (8227)
Length:
3199
CDS:
186..2273

Additional Resources:

NCBI RefSeq record:
NM_005088.3
NBCI Gene record:
AKAP17A (8227)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005088.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218426 ACTTGATCCGATAGCTTTAAT pLKO_005 2507 3UTR 100% 15.000 21.000 N AKAP17A n/a
2 TRCN0000229796 AGTTCTCCACGCTGCGTATTT pLKO_005 373 CDS 100% 13.200 18.480 N AKAP17A n/a
3 TRCN0000022044 GCGTATTTCCAAGAGCACCAT pLKO.1 386 CDS 100% 2.640 3.696 N AKAP17A n/a
4 TRCN0000229797 ACGTCCTGGTCAAGGTGTTTG pLKO_005 700 CDS 100% 10.800 8.640 N AKAP17A n/a
5 TRCN0000022045 CCTGAGTGATGCCTCAATTAA pLKO.1 971 CDS 100% 15.000 10.500 N AKAP17A n/a
6 TRCN0000229798 CTGAGTGATGCCTCAATTAAG pLKO_005 972 CDS 100% 13.200 9.240 N AKAP17A n/a
7 TRCN0000257207 GGCCTGCAACATCAAGGTTTC pLKO_005 932 CDS 100% 6.000 4.200 N AKAP17A n/a
8 TRCN0000022046 CCTGCAACATCAAGGTTTCTT pLKO.1 934 CDS 100% 5.625 3.938 N AKAP17A n/a
9 TRCN0000022048 GAGCGGAGGAAAGGAAACAAA pLKO.1 1084 CDS 100% 5.625 3.938 N AKAP17A n/a
10 TRCN0000022047 CTCCTGCATTCCTGACAACAA pLKO.1 1826 CDS 100% 4.950 3.465 N AKAP17A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005088.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07209 pDONR223 100% 99.8% 99.8% None 666C>T;1498C>G;1923G>A n/a
2 ccsbBroadEn_11263 pDONR223 100% 61.8% 55% None (many diffs) n/a
Download CSV