Transcript: Human NM_005112.5

Homo sapiens WD repeat domain 1 (WDR1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
WDR1 (9948)
Length:
2573
CDS:
134..1534

Additional Resources:

NCBI RefSeq record:
NM_005112.5
NBCI Gene record:
WDR1 (9948)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005112.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419490 CCACGACGGACACATTAATTA pLKO_005 736 CDS 100% 15.000 21.000 N WDR1 n/a
2 TRCN0000435904 CGAATCAGGGACTAGAGTTTA pLKO_005 1563 3UTR 100% 13.200 18.480 N WDR1 n/a
3 TRCN0000150914 GTGGGATTTACGCAATTAGTT pLKO.1 417 CDS 100% 5.625 7.875 N WDR1 n/a
4 TRCN0000184672 CGACCCTAAGGGCAACAATTT pLKO.1 208 CDS 100% 13.200 9.240 N WDR1 n/a
5 TRCN0000196220 GCACCCATTTGCTTTCTGCTT pLKO.1 450 CDS 100% 2.640 1.848 N WDR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005112.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07517 pDONR223 100% 76.8% 76.8% None 137_138ins420 n/a
2 ccsbBroad304_07517 pLX_304 0% 76.8% 76.8% V5 137_138ins420 n/a
3 TRCN0000467511 GCCGTTCCTTTTTTGCCCACTACG pLX_317 17.5% 76.8% 76.8% V5 137_138ins420 n/a
4 ccsbBroadEn_07516 pDONR223 100% 76.8% 76.8% None 137_138ins420;1015C>T n/a
5 ccsbBroad304_07516 pLX_304 0% 76.8% 76.8% V5 137_138ins420;1015C>T n/a
6 TRCN0000472452 CATGGAAGTGTCAGTGTGATCTGT pLX_317 26.8% 76.8% 76.8% V5 137_138ins420;1015C>T n/a
Download CSV