Transcript: Human NM_005133.3

Homo sapiens Ras converting CAAX endopeptidase 1 (RCE1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
RCE1 (9986)
Length:
1462
CDS:
16..1005

Additional Resources:

NCBI RefSeq record:
NM_005133.3
NBCI Gene record:
RCE1 (9986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005133.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271614 TTCGGTGCCTACACTGCTTTC pLKO_005 733 CDS 100% 6.000 8.400 N RCE1 n/a
2 TRCN0000050296 CGCGGTCATCAAGCGACGCTT pLKO.1 210 CDS 100% 0.000 0.000 N RCE1 n/a
3 TRCN0000050293 CTTCTGCAATTACATGGGTTT pLKO.1 801 CDS 100% 4.050 3.240 N RCE1 n/a
4 TRCN0000050294 GCCCATGTTAGCACCGTGCAT pLKO.1 567 CDS 100% 0.880 0.704 N RCE1 n/a
5 TRCN0000350648 CTGCCATTCCTTCTGCAATTA pLKO_005 792 CDS 100% 13.200 9.240 N RCE1 n/a
6 TRCN0000323105 CCCTGTTGCTGACCATGATTC pLKO_005 371 CDS 100% 10.800 7.560 N RCE1 n/a
7 TRCN0000271568 ATTATTGAGCAGCTGCGTTTC pLKO_005 649 CDS 100% 6.000 4.200 N RCE1 n/a
8 TRCN0000050297 CCATTCCTTCTGCAATTACAT pLKO.1 795 CDS 100% 5.625 3.938 N RCE1 n/a
9 TRCN0000050295 GCCCACTGATGCAGCTCTCTA pLKO.1 401 CDS 100% 1.650 1.155 N RCE1 n/a
10 TRCN0000284478 CACACTCCCTTCCTCACTTTG pLKO_005 1254 3UTR 100% 10.800 6.480 N RCE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005133.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02281 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02281 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481295 ACTGGATCCCGTTGTCAACCAGGA pLX_317 49.3% 100% 100% V5 n/a
Download CSV