Transcript: Human NM_005180.9

Homo sapiens BMI1 proto-oncogene, polycomb ring finger (BMI1), mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
BMI1 (648)
Length:
3540
CDS:
618..1598

Additional Resources:

NCBI RefSeq record:
NM_005180.9
NBCI Gene record:
BMI1 (648)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005180.9, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235391 AGCGGGTACTACCGTTTATTT pLKO_005 2204 3UTR 100% 15.000 7.500 Y Bmi1 n/a
2 TRCN0000218780 ATACTCCTATGGACGTTAATT pLKO_005 1757 3UTR 100% 15.000 7.500 Y BMI1 n/a
3 TRCN0000229416 ATTGATGCCACAACCATAATA pLKO_005 693 CDS 100% 15.000 7.500 Y BMI1 n/a
4 TRCN0000020155 CCAGACCACTACTGAATATAA pLKO.1 805 CDS 100% 15.000 7.500 Y BMI1 n/a
5 TRCN0000229417 GGAACCTTTAAAGGATTATTA pLKO_005 1208 CDS 100% 15.000 7.500 Y BMI1 n/a
6 TRCN0000218869 CAGATTGGATCGGAAAGTAAA pLKO_005 1040 CDS 100% 13.200 6.600 Y BMI1 n/a
7 TRCN0000235389 CAGCAAGTATTGTCCTATTTG pLKO_005 764 CDS 100% 13.200 6.600 Y Bmi1 n/a
8 TRCN0000012565 CCAGCAAGTATTGTCCTATTT pLKO.1 763 CDS 100% 13.200 6.600 Y Bmi1 n/a
9 TRCN0000229418 TAATGGATATTGCCTACATTT pLKO_005 1234 CDS 100% 13.200 6.600 Y BMI1 n/a
10 TRCN0000020156 CCTAATACTTTCCAGATTGAT pLKO.1 1173 CDS 100% 5.625 2.813 Y BMI1 n/a
11 TRCN0000020157 CGGAAAGTAAACAAAGACAAA pLKO.1 1050 CDS 100% 4.950 2.475 Y BMI1 n/a
12 TRCN0000020154 CCTACATTTATACCTGGAGAA pLKO.1 1246 CDS 100% 4.050 2.025 Y BMI1 n/a
13 TRCN0000020158 CCAGAACAGATTGGATCGGAA pLKO.1 1034 CDS 100% 2.640 1.320 Y BMI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005180.9, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00165 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00165 pLX_304 58.2% 100% 100% V5 n/a
3 TRCN0000474550 GTACCTAGACTTTCTACTCCCTTC pLX_317 55.7% 100% 100% V5 n/a
Download CSV