Transcript: Human NM_005183.4

Homo sapiens calcium voltage-gated channel subunit alpha1 F (CACNA1F), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CACNA1F (778)
Length:
6039
CDS:
32..5965

Additional Resources:

NCBI RefSeq record:
NM_005183.4
NBCI Gene record:
CACNA1F (778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005183.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000454237 CCTATCATCGTGGGCGAAATT pLKO_005 5496 CDS 100% 13.200 18.480 N CACNA1F n/a
2 TRCN0000452424 CTTTCGCCTCTTCCGAGTTAT pLKO_005 3913 CDS 100% 13.200 18.480 N CACNA1F n/a
3 TRCN0000043718 GCCTGCACATAGTGCTCAATT pLKO.1 696 CDS 100% 13.200 10.560 N CACNA1F n/a
4 TRCN0000446484 GTTTACCTGTGGTAGCAATTT pLKO_005 4258 CDS 100% 13.200 10.560 N CACNA1F n/a
5 TRCN0000043719 CCAGGACTATTTCCGCAAATT pLKO.1 4798 CDS 100% 13.200 9.240 N CACNA1F n/a
6 TRCN0000043722 CCAGCGTCAATGTGTGGAATA pLKO.1 3499 CDS 100% 10.800 7.560 N CACNA1F n/a
7 TRCN0000043720 CGTGGTCATGTATGATGGTAT pLKO.1 2173 CDS 100% 4.950 3.465 N CACNA1F n/a
8 TRCN0000043721 CCATCCCAGAAGAAGGAAATT pLKO.1 5214 CDS 100% 13.200 7.920 N CACNA1F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005183.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.