Transcript: Human NM_005185.4

Homo sapiens calmodulin like 3 (CALML3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CALML3 (810)
Length:
1811
CDS:
126..575

Additional Resources:

NCBI RefSeq record:
NM_005185.4
NBCI Gene record:
CALML3 (810)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005185.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053761 CGGAGACGGACAGGTGAACTA pLKO.1 521 CDS 100% 1.650 2.310 N CALML3 n/a
2 TRCN0000053759 CGTGTTCGACAAGGACGGCAA pLKO.1 398 CDS 100% 0.720 1.008 N CALML3 n/a
3 TRCN0000053758 GCGGGACATGATGAGTGAGAT pLKO.1 272 CDS 100% 4.950 3.960 N CALML3 n/a
4 TRCN0000053760 CGAGGAGTTTGTCCGTGTGCT pLKO.1 542 CDS 100% 0.880 0.704 N CALML3 n/a
5 TRCN0000438576 GAGAAGCAGAGCTGACCTTAG pLKO_005 830 3UTR 100% 6.000 4.200 N CALML3 n/a
6 TRCN0000442207 GACAGGTGAACTACGAGGAGT pLKO_005 529 CDS 100% 2.640 1.848 N CALML3 n/a
7 TRCN0000434929 TCCGTGTGCTGGTGTCCAAGT pLKO_005 553 CDS 100% 1.350 0.945 N CALML3 n/a
8 TRCN0000053762 TCACAGAATTCAAGGAGGCCT pLKO.1 154 CDS 100% 0.000 0.000 N CALML3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005185.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00209 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00209 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465706 TCCGATATATCCAATCTGGCCCCT pLX_317 72.8% 100% 100% V5 n/a
Download CSV