Transcript: Human NM_005188.4

Homo sapiens Cbl proto-oncogene (CBL), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
CBL (867)
Length:
11168
CDS:
80..2800

Additional Resources:

NCBI RefSeq record:
NM_005188.4
NBCI Gene record:
CBL (867)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005188.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379721 GACACATTTCGGATTACTAAA pLKO_005 608 CDS 100% 13.200 18.480 N CBL n/a
2 TRCN0000379971 GTACGTATGAAGCAATGTATA pLKO_005 2265 CDS 100% 13.200 18.480 N CBL n/a
3 TRCN0000295906 TGATCTGACCTGCAATGATTA pLKO_005 763 CDS 100% 13.200 18.480 N CBL n/a
4 TRCN0000380202 TGATCTGACCTGCAATGATTA pLKO_005 763 CDS 100% 13.200 18.480 N Cbl n/a
5 TRCN0000039724 CCGTACTATCTTGTCAAGATA pLKO.1 364 CDS 100% 0.563 0.788 N CBL n/a
6 TRCN0000381940 TACCAGCATCTCCGTACTATC pLKO_005 353 CDS 100% 0.000 0.000 N CBL n/a
7 TRCN0000380982 TTGCGACCAGCAGATTGATAG pLKO_005 2242 CDS 100% 10.800 8.640 N CBL n/a
8 TRCN0000039727 GCCGATGTGAAATTAAAGGTA pLKO.1 1335 CDS 100% 3.000 2.400 N CBL n/a
9 TRCN0000288694 GCCGATGTGAAATTAAAGGTA pLKO_005 1335 CDS 100% 3.000 2.400 N CBL n/a
10 TRCN0000039723 CCAGTGAGTTGGGAGTTATTA pLKO.1 2832 3UTR 100% 15.000 10.500 N CBL n/a
11 TRCN0000288695 CCAGTGAGTTGGGAGTTATTA pLKO_005 2832 3UTR 100% 15.000 10.500 N CBL n/a
12 TRCN0000039726 CCCTCACAATAAACCTCTCTT pLKO.1 1033 CDS 100% 4.950 3.465 N CBL n/a
13 TRCN0000288631 CCCTCACAATAAACCTCTCTT pLKO_005 1033 CDS 100% 4.950 3.465 N CBL n/a
14 TRCN0000010310 GACAAGAAGATGGTGGAGAAG pLKO.1 233 CDS 100% 4.050 2.835 N CBL n/a
15 TRCN0000039725 CCCTTCATAAAGACAAACCAT pLKO.1 1656 CDS 100% 3.000 2.100 N CBL n/a
16 TRCN0000295905 ATATCACATCAGTGGTTCCA pLKO_005 2923 3UTR 100% 0.000 0.000 N CBL n/a
17 TRCN0000010311 GATATCACATCAGTGGTTCC pLKO.1 2922 3UTR 100% 0.000 0.000 N CBL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005188.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.