Transcript: Human NM_005231.4

Homo sapiens cortactin (CTTN), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CTTN (2017)
Length:
3249
CDS:
184..1836

Additional Resources:

NCBI RefSeq record:
NM_005231.4
NBCI Gene record:
CTTN (2017)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005231.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040275 CACGAATATCAGTCGAAACTT pLKO.1 487 CDS 100% 5.625 7.875 N CTTN n/a
2 TRCN0000298256 CACGAATATCAGTCGAAACTT pLKO_005 487 CDS 100% 5.625 7.875 N CTTN n/a
3 TRCN0000040273 CGGCAAATACGGTATCGACAA pLKO.1 771 CDS 100% 4.050 5.670 N CTTN n/a
4 TRCN0000286857 CGGCAAATACGGTATCGACAA pLKO_005 771 CDS 100% 4.050 5.670 N CTTN n/a
5 TRCN0000040274 GCAAGACTACTCCAAAGGATT pLKO.1 1080 CDS 100% 4.950 6.435 N CTTN n/a
6 TRCN0000286902 GCAAGACTACTCCAAAGGATT pLKO_005 1080 CDS 100% 4.950 6.435 N CTTN n/a
7 TRCN0000294182 CCACAGAATTTGCTAATATAT pLKO_005 2026 3UTR 100% 15.000 10.500 N CTTN n/a
8 TRCN0000294181 GTAACATCAGAGCTAACTTTG pLKO_005 1226 CDS 100% 10.800 7.560 N CTTN n/a
9 TRCN0000040276 GAAAGACTACTCCAGTGGTTT pLKO.1 636 CDS 100% 4.950 3.465 N CTTN n/a
10 TRCN0000040277 GAGATCTCATTTGACCCTGAT pLKO.1 1711 CDS 100% 4.050 2.835 N CTTN n/a
11 TRCN0000108890 CCTCCCAGAAAGACTACTCTA pLKO.1 629 CDS 100% 4.950 2.970 N Cttn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005231.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06159 pDONR223 100% 93.1% 93.2% None 781_891del;898C>A;1458C>T n/a
2 ccsbBroad304_06159 pLX_304 0% 93.1% 93.2% V5 781_891del;898C>A;1458C>T n/a
3 TRCN0000465868 TCGACCCCGAATAAACTTGGCATC pLX_317 26% 93.1% 93.2% V5 781_891del;898C>A;1458C>T n/a
Download CSV